Site Loader

    2. Abdoul-Azize S, DubusI, Vannier JP. Improvement of dexamethasone sensitivity by chelation ofintracellular Ca2+ in pediatric acute lymphoblastic leukemia cellsthrough the prosurvival kinase ERK1/2 deactivation. Oncotarget 2017; 8:27339-52.

1. Simon T, Coquerel B, Petit A, Kassim Y, Demange E, Le Cerf D, et al.Direct effect of bevacizumab on glioblastoma cell lines in vitro.

Best services for writing your paper according to Trustpilot

Premium Partner
From $18.00 per page
4,8 / 5
4,80
Writers Experience
4,80
Delivery
4,90
Support
4,70
Price
Recommended Service
From $13.90 per page
4,6 / 5
4,70
Writers Experience
4,70
Delivery
4,60
Support
4,60
Price
From $20.00 per page
4,5 / 5
4,80
Writers Experience
4,50
Delivery
4,40
Support
4,10
Price
* All Partners were chosen among 50+ writing services by our Customer Satisfaction Team

Neuromolecular Med 2014; 16:752-71.Supplemental References       NucleoSpin® RNA XS-column (Macherey-Nagel, Düren,Germany) was used to extract total RNA from cells according to themanufacturer’s instructions. 1 ?g of RNA reverse-transcribed into cDNA usingiScript cDNA synthesis kit (Bio-Rad). qPCR amplification was done using iQ™SYBR® Green supermix (Bio-Rad) method according to themanufacturer’s instructions under the Roche LightCycler480 System. Gene expressionwas normalized to GAPDH gene. Primers used to evaluate gene expression were asfollows (5′ to 3′): Stim1 forward gcagagttttgccgaattg and reversetgaggtgattatggcgagtc; Orai1 forward gagttactccgaggtgatga and reversegaccgagttgagattgtgc; Orai2 forward catggattaccgggactg and reversecacggggaggaacttgat; Orai3 forward ttgctgaagttgtcctgg and reversetcctctagttcctgcttgtag; Trpc1 forward ctggtatgaagggttggaaga and reverseaaagcaggtgccaatgaac; Trpc3 forward atgacagtgatgcgggaga and reversecctcgtcgtaagcgtagaagt; Trpc4 forward tggatgatattaccgtgggt and reversecttcaaaatgtccaggagca; Trpc5 forward ctccctctacctggcaactat and reversegctcctacaaactcggtgaat; Trpc6 forward tttactggtttgctccatgc and reverseagaggggtcccactttatcc; Trpc7 forward cgacgacgacttctatgcct and reversecgcccactacaaaatcctt; Gapdh forward aacagcgacacccactcctc and reverse ggaggggagattcagtgtggt. 2-??CT referred to the fold-change of the RNAexpression of one sample when compared to the internal control sample.RNA extraction and RT-qPCR Wound-healingassay was used to evaluate cells migration.

Wounds were generated by scraping a80% confluent cell monolayer through a pipette tip and gently washed with PBS. Cells were then maintainedin RPMI containing 10% FBS with BAPTA-AM (5 µM) or EGTA (100 µM) for 30 minthen stimulated with or without simvastatin (100 nM) or doxorubicin (1 µM).Images of wounds were taken immediately and 6 h after wounding. Wound areaswere measured in 5 random fields by Saisam software (Microvision Instruments,Evry, France) and photographed by Axiovert 135 microscope (Zeiss, Le Pecq,France) with a Sony DXC-930P video camera. Wound closure was estimated as the percentageof wound area change.Cellmigration assay To measure the cellular activity of caspase-3, we usedthe method described previously2. For breast cancer cell xenografts,tissues were rapidly chopped with scissors and lysates were prepared using thesame buffer described before2.

Measurementof Caspase-3 Activity Phase contrast images were captured using an Axiovert 135 microscope(Zeiss, Le Pecq, France) with a Sony 3-CCD color video camera (DXC-930P) andthe Saisam software (Microvision Instruments, Evry, France).Phasecontrast imaging HA hydrogels-containing cells were placed in a 96-well plate and colonieswere grown for 6 days. Forcolony quantification, cell colonies were evaluated using MTT method2.The values of control treatment were considered as 100%.Cell colonies counting At the end of invasion period, in some experiments, HAHydrogels were fixed, followed by rinses, then permeabilized and stained with DAPIfor 1 h 30 at room temperature. After additional three washing, cells coloniesin HA hydrogels were visualized and photographed under Zeiss Axiovert 200Mfluorescence microscope.

Cell colonies fixation and DAPI staining We defined cellular invasiveness as the capacity oftumor cells to penetrate HA hydrogel to form colonies according to the methoddescribed recently1. The cells were treated with simvastatin (100nM) or doxorubicin (1 µM) during the HA hydrogel penetration period and thecolonies formation period (Fig. 6D) in the presence or absence of extracellularCa2+ chelator (EGTA, 100 µM) or intracellular Ca2+chelator (BAPTA-AM, 5 µM). Cells invasiveness and colony formation in HA hydrogels Breastcarcinoma samples were received from the Rouen Henri Becquerel Cancer Center (France)after approval of the protocols by its Review committee in accordance with the HelsinkiDeclaration. All subjects (supplementary Table 1) associated withthis study have signed a written consent for the use of their samples. Theselatter were isolated from five donors, ages 40, 47, 50, 51 and 58, and transferredin ice-cold RPMI 1640 medium to the laboratory at Rouen University within 0.5to 1 hour.

Once atthe laboratory, samples were rapidly chopped with scissors and digested at 37°C for 3 hin serum-free low-glucose-DMEM medium containing 200 U / ml collagenase II(Sigma), 50 U / ml DNase and 5 mM CaCl2. A 100 µm Nylon Mesh CellStrainer (BD Falcon, Le Pont de Claix, France) was used for obtaining asingle-cell suspension. Cells were then pelleted by low-speed centrifugationand cultured in complete low-glucose-DMEM medium as described above.Humanbreast tumor dissociation The human breast carcinoma cell lines MDA-MB-231 andMCF-7 were used in the study and obtained from the European Collection ofAuthenticated Cell Cultures (ECACC, Porton Down, SP4 0JG Salisbury, UK).

MDA-MB-231 and MCF-7 cells were cultured in RPMI 1640 and low-glucose-DMEM medium(Eurobio®, Courtaboeuf, France), respectively. These were completed with 10%fetal bovine serum (FBS), 2 mM of L-glutamine, 5000 UI/L penicillin and 50 mg/Lstreptomycin, all from Eurobio®. Cells were maintained at 37°C in a 5% CO2.The reagents as Rhod-2/AM, Fura-2/AM, 1, 2-bis (2-aminophenoxy)ethane-N,N,N,N-tetraacetic acid (BAPTA-AM), U73122 and SKF96365 were purchasedfrom Abcam Biochemicals (Paris, France). Simvastatin, Poly-D-lysine,dimethylsulfoxide (DMSO), 2-APB, DAPI and ethylene glycol tetraacetic acid(EGTA) were purchased from Sigma Aldrich (St-Quentin Fallavier, France).Doxorubicin chlorhydrate was purchased from Amersham Pharmacia Biotech, Inc.(Uppsala, Sweden).

Ac-DEVD-AFCsubstrate, N-Acetyl-L-Cysteine (NAC) was obtained from Enzo Life Sciences(ELS) AG, Villeurbanne, France. Anti-phospho-Erk1/2, GAPDH antibody for loading control and the antibody againstcleaved caspase-3 were purchased from Cell Signaling Technology. Stim1 antibody,TRPC1 antibody, TRPC3 antibody, BIM-phycoerythrin monoclonal antibody IgG1, JC-10 dye, Dihydrorhodamine123 (DHR 123)  were obtained from SantaCruz Biotechnology.

The secondary Antibody, Alexa Fluor® 700 conjugate camefrom Thermo Fisher Scientific.Cell lines, antibodies and Reagents SupplementaryMaterials and Methods

Post Author: admin

x

Hi!
I'm Eric!

Would you like to get a custom essay? How about receiving a customized one?

Check it out